ID: 1109748832_1109748835

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1109748832 1109748835
Species Human (GRCh38) Human (GRCh38)
Location 13:66663286-66663308 13:66663325-66663347
Sequence CCTTTCACCATTAATATTTATTG CAGGATTCTTCCAAATATGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 47, 4: 443} {0: 1, 1: 0, 2: 2, 3: 30, 4: 277}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!