|
Left Crispr |
Right Crispr |
| Crispr ID |
1109755157 |
1109755161 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
13:66748877-66748899
|
13:66748899-66748921
|
| Sequence |
CCTTGTGTCAAGGGCAGGACTAG |
GGTGGAGATAAGTGAATCATGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 8, 1: 94, 2: 245, 3: 567, 4: 1359} |
{0: 11, 1: 755, 2: 1547, 3: 3758, 4: 7958} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|