ID: 1109759537_1109759542

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1109759537 1109759542
Species Human (GRCh38) Human (GRCh38)
Location 13:66809233-66809255 13:66809266-66809288
Sequence CCACCGCGCCAGGCCTTTTAAAT TAGAAGAGTACCTTGAGGCTAGG
Strand - +
Off-target summary {0: 1, 1: 6, 2: 47, 3: 499, 4: 3895} {0: 1, 1: 0, 2: 2, 3: 33, 4: 543}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!