ID: 1109761111_1109761115

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1109761111 1109761115
Species Human (GRCh38) Human (GRCh38)
Location 13:66830261-66830283 13:66830296-66830318
Sequence CCATATGACTGTTCAACCTGGAC AGTCTAGAGGCTGCTTCATTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 56} {0: 1, 1: 0, 2: 1, 3: 9, 4: 114}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!