ID: 1109780674_1109780676

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1109780674 1109780676
Species Human (GRCh38) Human (GRCh38)
Location 13:67106905-67106927 13:67106919-67106941
Sequence CCAGCACACTGCAGCCTTGGCCC CCTTGGCCCCCTGTGTAATTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 12, 3: 127, 4: 909} {0: 1, 1: 0, 2: 6, 3: 164, 4: 2098}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!