|
Left Crispr |
Right Crispr |
| Crispr ID |
1109782525 |
1109782529 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
13:67130664-67130686
|
13:67130703-67130725
|
| Sequence |
CCAGAACTGCCTCATCATAGGAA |
GGCCAGAACTGCCTCATCATAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 2, 1: 5, 2: 9, 3: 25, 4: 168} |
{0: 6, 1: 13, 2: 11, 3: 20, 4: 129} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|