ID: 1109868660_1109868664

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1109868660 1109868664
Species Human (GRCh38) Human (GRCh38)
Location 13:68301947-68301969 13:68301979-68302001
Sequence CCTCCACGGCCACTTCAAGAAAA GCCACTTCGACCTCTTTGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 130} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!