ID: 1109908952_1109908956

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1109908952 1109908956
Species Human (GRCh38) Human (GRCh38)
Location 13:68885333-68885355 13:68885360-68885382
Sequence CCCCTGCATGGACTGAAGACCAT CAGTCACAGCAGTGTGACACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 110} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!