ID: 1109936329_1109936334

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1109936329 1109936334
Species Human (GRCh38) Human (GRCh38)
Location 13:69289670-69289692 13:69289701-69289723
Sequence CCAAGAACGCTCTCTAGGGGCCT ACCCCTTTGCTGTAACAAAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 41, 3: 822, 4: 998} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!