ID: 1109951022_1109951026

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1109951022 1109951026
Species Human (GRCh38) Human (GRCh38)
Location 13:69502193-69502215 13:69502232-69502254
Sequence CCCAGTAACAGGCCAAGAGCTGT AGTTATCTGCAGAAGATAGCAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!