|
Left Crispr |
Right Crispr |
| Crispr ID |
1109968966 |
1109968969 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
13:69739503-69739525
|
13:69739528-69739550
|
| Sequence |
CCTATCTCACATGCAAAGACATA |
CAGACAAAATAAAAGGATGGAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 36, 1: 627, 2: 2410, 3: 4935, 4: 3535} |
{0: 1, 1: 0, 2: 7, 3: 159, 4: 4095} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|