ID: 1110157023_1110157024

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1110157023 1110157024
Species Human (GRCh38) Human (GRCh38)
Location 13:72329822-72329844 13:72329837-72329859
Sequence CCAAGCTCAAGCACTGGTAGGTT GGTAGGTTTGTTGTCTGTTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 102} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!