|
Left Crispr |
Right Crispr |
Crispr ID |
1110212297 |
1110212309 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
13:72987944-72987966
|
13:72987984-72988006
|
Sequence |
CCTCCGCCCCCCGGGTTTATGTG |
TCCCAAGTAACTGGGACTACAGG |
Strand |
- |
+ |
Off-target summary |
{0: 1, 1: 3, 2: 201, 3: 6427, 4: 41002} |
{0: 1213, 1: 46838, 2: 161917, 3: 225153, 4: 236742} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|