|
Left Crispr |
Right Crispr |
| Crispr ID |
1110212302 |
1110212307 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
13:72987953-72987975
|
13:72987976-72987998
|
| Sequence |
CCCGGGTTTATGTGATTCTCCTG |
CCTCAGCCTCCCAAGTAACTGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 6, 1: 1087, 2: 39910, 3: 122362, 4: 208957} |
{0: 2835, 1: 101216, 2: 211662, 3: 252465, 4: 268723} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|