|
Left Crispr |
Right Crispr |
Crispr ID |
1110212303 |
1110212305 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
13:72987954-72987976
|
13:72987975-72987997
|
Sequence |
CCGGGTTTATGTGATTCTCCTGC |
GCCTCAGCCTCCCAAGTAACTGG |
Strand |
- |
+ |
Off-target summary |
{0: 9, 1: 1130, 2: 38661, 3: 98871, 4: 146931} |
{0: 2348, 1: 88449, 2: 198708, 3: 240149, 4: 234925} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|