ID: 1110219583_1110219594

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1110219583 1110219594
Species Human (GRCh38) Human (GRCh38)
Location 13:73059219-73059241 13:73059253-73059275
Sequence CCTCCCCTCCTCCGCCGGCAGCC TCGCCGACCCAAGCCAGCGTGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 5, 3: 92, 4: 844} {0: 1, 1: 0, 2: 0, 3: 1, 4: 17}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!