ID: 1110222570_1110222579

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1110222570 1110222579
Species Human (GRCh38) Human (GRCh38)
Location 13:73089288-73089310 13:73089323-73089345
Sequence CCTCCCACCTTGCCCTTCCAAAG AAGGCATGAGCCGTGGTGCCTGG
Strand - +
Off-target summary No data {0: 1, 1: 8, 2: 256, 3: 2188, 4: 23812}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!