ID: 1110274894_1110274898

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1110274894 1110274898
Species Human (GRCh38) Human (GRCh38)
Location 13:73632376-73632398 13:73632419-73632441
Sequence CCCAGGCGTGCAGGGTATCTGTG GCCTCAGCTCTGGTGCTGCCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 7, 3: 25, 4: 334}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!