|
Left Crispr |
Right Crispr |
| Crispr ID |
1110281387 |
1110281402 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
13:73698149-73698171
|
13:73698193-73698215
|
| Sequence |
CCCGAAAGAAAGAAAGAAAAGAG |
GAGGGGAAAGGGAAGGAGGAGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 8, 2: 48, 3: 436, 4: 3073} |
{0: 1, 1: 13, 2: 164, 3: 1340, 4: 7979} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|