ID: 1110339268_1110339277

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1110339268 1110339277
Species Human (GRCh38) Human (GRCh38)
Location 13:74370114-74370136 13:74370147-74370169
Sequence CCCAGTGAGGGTAGGCACCATCC GGCCCAGATAGGACTAAAGGAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 17, 3: 74, 4: 231} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!