ID: 1110399944_1110399950

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1110399944 1110399950
Species Human (GRCh38) Human (GRCh38)
Location 13:75078496-75078518 13:75078530-75078552
Sequence CCCTCATACTTCTACCATCTGTG CTCATGAAAATTTTCAGGCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 175} {0: 1, 1: 0, 2: 1, 3: 27, 4: 251}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!