|
Left Crispr |
Right Crispr |
| Crispr ID |
1110419740 |
1110419741 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
13:75292875-75292897
|
13:75292892-75292914
|
| Sequence |
CCGGGCGTGTTGGCTCACATCTG |
CATCTGTAAACCCAACAATTTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 3, 1: 377, 2: 7126, 3: 38537, 4: 110477} |
{0: 1, 1: 18, 2: 840, 3: 15219, 4: 116764} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|