|
Left Crispr |
Right Crispr |
Crispr ID |
1110419740 |
1110419743 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
13:75292875-75292897
|
13:75292896-75292918
|
Sequence |
CCGGGCGTGTTGGCTCACATCTG |
TGTAAACCCAACAATTTGGGAGG |
Strand |
- |
+ |
Off-target summary |
{0: 3, 1: 377, 2: 7126, 3: 38537, 4: 110477} |
{0: 3, 1: 572, 2: 28991, 3: 347622, 4: 322239} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|