ID: 1110432717_1110432723

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1110432717 1110432723
Species Human (GRCh38) Human (GRCh38)
Location 13:75443749-75443771 13:75443784-75443806
Sequence CCCTGTCCCTACTCAGAATCACA GCAGAGACCAGGAAAAGCCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 36, 4: 826} {0: 1, 1: 1, 2: 5, 3: 48, 4: 425}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!