ID: 1110436155_1110436159

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1110436155 1110436159
Species Human (GRCh38) Human (GRCh38)
Location 13:75480944-75480966 13:75480963-75480985
Sequence CCGTCCTCCCGGGACGGGCGCTC GCTCCTCCACGCGTGCTCCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 88} {0: 1, 1: 0, 2: 2, 3: 8, 4: 108}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!