ID: 1110558390_1110558405

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1110558390 1110558405
Species Human (GRCh38) Human (GRCh38)
Location 13:76885714-76885736 13:76885746-76885768
Sequence CCCGCGCCGCGAGGGCGGCGGCC GCTGCTGGGGCGCCCCGAGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 31, 4: 269} {0: 1, 1: 0, 2: 4, 3: 26, 4: 259}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!