ID: 1110564695_1110564699

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1110564695 1110564699
Species Human (GRCh38) Human (GRCh38)
Location 13:76946513-76946535 13:76946553-76946575
Sequence CCATAAGATGCCACAATTTGGTG AGACATTGCCCAATGTCCTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 104} {0: 1, 1: 48, 2: 300, 3: 750, 4: 1316}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!