ID: 1110576837_1110576842

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1110576837 1110576842
Species Human (GRCh38) Human (GRCh38)
Location 13:77067231-77067253 13:77067254-77067276
Sequence CCTGAACTTTACTTTATTCCCCC ATATTTATTTCTTTTTATTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 187} {0: 1, 1: 2, 2: 42, 3: 415, 4: 4002}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!