ID: 1110592525_1110592529

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1110592525 1110592529
Species Human (GRCh38) Human (GRCh38)
Location 13:77280780-77280802 13:77280807-77280829
Sequence CCCATAAAACTTTGGTCACAATG TAGGGAACTCTTCATCTGTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 326} {0: 1, 1: 0, 2: 1, 3: 9, 4: 105}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!