ID: 1110596545_1110596556

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1110596545 1110596556
Species Human (GRCh38) Human (GRCh38)
Location 13:77326627-77326649 13:77326662-77326684
Sequence CCCGCAGCAGCCACGGAGCCGTC GAACAGCGCCCCCGGCGCCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 173} {0: 1, 1: 0, 2: 1, 3: 9, 4: 105}
Status Complete

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
12 13:77326627-77326649 CCCGCAGCAGCCACGGAGCCGTC - 13:77326662-77326684 GAACAGCGCCCCCGGCGCCGGGG +