ID: 1110596879_1110596883

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1110596879 1110596883
Species Human (GRCh38) Human (GRCh38)
Location 13:77329139-77329161 13:77329180-77329202
Sequence CCGGGCTCTTCCCACCATTCATT ACTGCTGTTCAGTCCCAGACAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 21, 4: 290} {0: 1, 1: 0, 2: 0, 3: 13, 4: 148}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!