ID: 1110596882_1110596887

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1110596882 1110596887
Species Human (GRCh38) Human (GRCh38)
Location 13:77329153-77329175 13:77329199-77329221
Sequence CCATTCATTAATTTCGCTTCAAT CAGGCCCCTACGGAGCCTGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 30, 4: 244} {0: 1, 1: 0, 2: 0, 3: 13, 4: 98}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!