ID: 1110620172_1110620182

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1110620172 1110620182
Species Human (GRCh38) Human (GRCh38)
Location 13:77586010-77586032 13:77586053-77586075
Sequence CCCTCCTCCCTGAAACTCTCCAT TGTGAGCTTCTCATCTTTGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 11, 3: 68, 4: 536} {0: 1, 1: 1, 2: 1, 3: 11, 4: 229}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!