ID: 1110631890_1110631893

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1110631890 1110631893
Species Human (GRCh38) Human (GRCh38)
Location 13:77718156-77718178 13:77718171-77718193
Sequence CCTTACCTGTAACTGGAGTGAAC GAGTGAACAAACTGTCTCAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 84} {0: 1, 1: 0, 2: 2, 3: 15, 4: 135}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!