ID: 1110633410_1110633411

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1110633410 1110633411
Species Human (GRCh38) Human (GRCh38)
Location 13:77736646-77736668 13:77736659-77736681
Sequence CCTTATGTCTTCTGCTGAATCTG GCTGAATCTGCTCTCATCAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 241} {0: 1, 1: 0, 2: 0, 3: 15, 4: 121}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!