ID: 1110636113_1110636121

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1110636113 1110636121
Species Human (GRCh38) Human (GRCh38)
Location 13:77768496-77768518 13:77768542-77768564
Sequence CCTTATGTAAATCAGATACCGCC AACCGCATCCCGCTGCTAACAGG
Strand - +
Off-target summary {0: 4, 1: 90, 2: 339, 3: 469, 4: 401} {0: 1, 1: 0, 2: 0, 3: 2, 4: 31}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!