ID: 1110636114_1110636126

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1110636114 1110636126
Species Human (GRCh38) Human (GRCh38)
Location 13:77768514-77768536 13:77768555-77768577
Sequence CCGCCTCCTCGAGCCCCTCTATA TGCTAACAGGGAGATCCATTCGG
Strand - +
Off-target summary {0: 1, 1: 6, 2: 8, 3: 138, 4: 402} {0: 1, 1: 0, 2: 3, 3: 10, 4: 96}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!