ID: 1110636117_1110636121

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1110636117 1110636121
Species Human (GRCh38) Human (GRCh38)
Location 13:77768527-77768549 13:77768542-77768564
Sequence CCCCTCTATAAAACCAACCGCAT AACCGCATCCCGCTGCTAACAGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 2, 3: 14, 4: 90} {0: 1, 1: 0, 2: 0, 3: 2, 4: 31}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!