ID: 1110636118_1110636122

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1110636118 1110636122
Species Human (GRCh38) Human (GRCh38)
Location 13:77768528-77768550 13:77768543-77768565
Sequence CCCTCTATAAAACCAACCGCATC ACCGCATCCCGCTGCTAACAGGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 4, 3: 17, 4: 100} {0: 1, 1: 0, 2: 0, 3: 7, 4: 28}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!