ID: 1110740255_1110740260

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1110740255 1110740260
Species Human (GRCh38) Human (GRCh38)
Location 13:78987016-78987038 13:78987044-78987066
Sequence CCTATAGAGCTCAATTGGCCCTT CACCTGCCCGAACAGCATCCGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 6, 4: 95}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!