ID: 1110830767_1110830771

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1110830767 1110830771
Species Human (GRCh38) Human (GRCh38)
Location 13:80028252-80028274 13:80028304-80028326
Sequence CCATGTTCCATTAATTACATCAT GTGTCCTTCCTGATAAATTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 248} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!