ID: 1110833383_1110833386

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1110833383 1110833386
Species Human (GRCh38) Human (GRCh38)
Location 13:80057102-80057124 13:80057138-80057160
Sequence CCAAACAGAGGCTTAAAAAATTA CTCATGTAGAAGTCTGGAGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 43, 4: 369} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!