ID: 1110834020_1110834037

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1110834020 1110834037
Species Human (GRCh38) Human (GRCh38)
Location 13:80063783-80063805 13:80063834-80063856
Sequence CCATGTGTAACCTCCATCCCTGC TTGGGCAATGACGGGTTGGCTGG
Strand - +
Off-target summary {0: 64, 1: 132, 2: 179, 3: 209, 4: 422} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!