ID: 1110834131_1110834138

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1110834131 1110834138
Species Human (GRCh38) Human (GRCh38)
Location 13:80064608-80064630 13:80064656-80064678
Sequence CCACCAAAGCCCAGTAACAGGCC TGTTATCTGCAGAAGATGGCAGG
Strand - +
Off-target summary {0: 144, 1: 161, 2: 86, 3: 68, 4: 218} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!