ID: 1110860118_1110860124

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1110860118 1110860124
Species Human (GRCh38) Human (GRCh38)
Location 13:80339006-80339028 13:80339025-80339047
Sequence CCCCAGACTCAGACAGGCGGGGG GGGGCCGCGGGCGCCTCCGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 205} {0: 1, 1: 1, 2: 2, 3: 16, 4: 205}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!