ID: 1110889807_1110889821

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1110889807 1110889821
Species Human (GRCh38) Human (GRCh38)
Location 13:80684768-80684790 13:80684813-80684835
Sequence CCTTCCTCCCTTCCTCCCCCTCT AGGACCTGGGTGGGTACAGAAGG
Strand - +
Off-target summary {0: 4, 1: 33, 2: 850, 3: 7693, 4: 29360} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!