ID: 1110977026_1110977030

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1110977026 1110977030
Species Human (GRCh38) Human (GRCh38)
Location 13:81851380-81851402 13:81851420-81851442
Sequence CCTAGACTGTTCATAGATTGAAA TAAGGAAAACAGAAGGAAGAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 13, 3: 170, 4: 1420}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!