ID: 1110988934_1110988941

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1110988934 1110988941
Species Human (GRCh38) Human (GRCh38)
Location 13:82012277-82012299 13:82012320-82012342
Sequence CCTTATTTTTCCTCCACTCCCTA TGTGGATAATTTACACTTGAGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!