ID: 1110998547_1110998550

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1110998547 1110998550
Species Human (GRCh38) Human (GRCh38)
Location 13:82145935-82145957 13:82145966-82145988
Sequence CCTATCTGCATTTTTCTCTCCAA CTTCTCGAGGCCAAAATAATTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!