ID: 1111197472_1111197475

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1111197472 1111197475
Species Human (GRCh38) Human (GRCh38)
Location 13:84894126-84894148 13:84894142-84894164
Sequence CCTTTGCGGCGTTACAAGTCATA AGTCATAAAGGCGGCGCCGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 45} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!